Sale!

Molecular Biology Principles and Practice 2nd Edition Cox Doudna ODonnell Test Bank

$80.00 $13.97

Molecular Biology Principles and Practice 2nd Edition Cox Doudna ODonnell Test Bank

ISBN-13: 978-1464126147

ISBN-10: 1464126143

 

Category: Tag:

Description

Molecular Biology Principles and Practice 2nd Edition Cox Doudna ODonnell Test Bank

ISBN-13: 978-1464126147

ISBN-10: 1464126143

 

 

How can a nursing test bank help me in school?

  Think about it like this. You have one text book in your class. So does your teacher. Each text book has one test bank that teachers use to test students with. This is the nursing test bank for the book you have. All authentic chapters and questions and answers are included.

Do I get to download this nursing test bank today?

Since we know that students want their files fast, we listened and made it exactly the way you want. So you can download your entire test bank today without waiting for it.

Is this site anonymous and discreet?

We try our best to give nursing students exactly what they want. So your order is 100 percent anonymous and discreet. We do not keep any logs of any kind on our website and use a 256 bit SSL encryption on our site which you can verify.

What if I order the wrong test bank?

As long as the file is not downloaded, we can give you the correct file. Please send us an email and we will send you the correct file right away.

Can I request a sample before I purchase to make sure its authentic?

If this is the nursing test bank that you want. You can use it right now without having to wait for it. Add this exact test bank to your shopping basket on this website. Thereafter, checkout. Your download link will be provided to you automatically.

What format are the nursing test banks in when I download them?

Most of the formats are going to be in a PDF format. We also have files in Microsoft Word. They can be viewed on your computer or phone.

Where to purchase the textbook instead of the test bank?

That is available on Amazon.

Can I write a review and leave a testimonial on this site?

You certainly can. Please email us sending an email to us. Many students send us emails thanking us for helping them.

Below you will find some free nursing test bank questions from this test bank:

Molecular Biology- Principles and Practice 2e

Cox et. al

Chapter 17

 

  1. The “adaptor” molecule that was hypothesized Francis Crick to link amino acids to mRNA is actually which type of biomolecule?

 

  1. protein
  2. DNA
  3. tRNA
  4. rRNA

 

Answer: C

Section: 17.1

Level: Easy

Blooms: Knowledge

 

 

  1. What is the sequence of the last three nucleotides of all mature tRNA molecules?

 

  1. ACC
  2. CCA
  3. TGG
  4. GGT

 

Answer: B

Section: 17.1

Level: Easy

Blooms: Knowledge

 

 

  1. Which one of the following is not true of tRNA molecules?

 

  1. tRNA molecules are single-stranded RNA.
  2. The 3′-terminal nucleotide of tRNA is the site of amino acid attachment.
  3. The anticodon arm of tRNA contains a three nucleotide sequence that is identical to a specific mRNA codon.
  4. tRNA molecules contain the unusual nucleotides dihydrouridine, pseudouridine, and ribothymine.

 

Answer: C

Section: 17.1

Level: Medium

Blooms: Analysis

 

 

  1. Which one of the following describes a tRNA molecule that specifically recognizes the codon for the amino acid histidine, but is covalently bound (charged with) to the amino acid serine?

 

  1. histinyl-tRNASer
  2. histinyl-tRNAHis
  3. seryl-tRNASer
  4. seryl-tRNAHis

 

Answer: D

Section: 17.1

Level: Easy

Blooms: Application

 

 

  1. The two codons for glutamine are CAA and CAG. Which one of the following is likely to be the anticodon of a tRNA that is specific for glutamine?

 

  1. GUC
  2. CGU
  3. CUG
  4. GCU

 

Answer: C

Section: 17.1

Level: Easy

Blooms: Analysis

 

 

  1. What is the approximate minimum length of an mRNA molecule that encodes a protein with a molecular weight of 30,000? (The average molecular weight of an amino acid is 110.)

 

  1. 275 nucleotides
  2. 550 nucleotides
  3. 825 nucleotides
  4. 2,475 nucleotides

 

Answer: C

Section: 17.1

Level: Hard

Blooms: Synthesis

 

 

  1. Which one of the following mRNA sequences could encode for the peptide Met-Ala-His-Ser?

 

 

  1. AUGAAUCACUCU
  2. AUGGCUCACAGC
  3. UCUCACGCUAUG
  4. AUGAAUCAUUCA

 

Answer: B

Section: 17.1

Level: Medium

Blooms: Application

 

 

  1. Which one of the following polypeptide sequences will be made from the RNA sequence shown, translating from the first start codon to the stop codon?

 

5′- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU

 

  1. Arg-His-Ala
  2. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly-Tyr-Pro-Phe
  3. Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly
  4. Met-Pro-Lys-Ile

 

Answer: C

Section: 17.1

Level: Medium

Blooms: Application

 

 

  1. How many codons of the genetic code are used for coding amino acids?

 

  1. 61
  2. 64
  3. 20
  4. 128

 

Answer: A

Section: 17.1

Level: Easy

Blooms: Comprehension

 

 

  1. The genetic code is degenerate because:

 

  1. one particular amino acid can only be encoded one codon.
  2. not all possible codons are used to code for amino acids.
  3. one particular amino acid can be encoded more than one codon.
  4. one particular codon can code for more than one amino acid.

 

Answer: C

Section: 17.1

Level: Easy

Blooms: Comprehension

 

 

  1. The reading frame of mRNA is:

 

  1. all of the nucleotides of an mRNA molecule.
  2. any three nucleotides that can base pair with an anticodon.
  3. the first three nucleotides of a gene.
  4. a continuous, nonoverlapping set of three-nucleotide codons.

 

Answer: D

Section: 17.1

Level: Easy

Blooms: Knowledge

 

 

  1. Which one of the following statements about the genetic code is true?

 

  1. A bacterial mRNA of 800 nucleotides could code for a 300 amino acid protein.
  2. There are at least three codons for each amino acid.
  3. A new codon begins every three nucleotides.
  4. The fourth codon establishes the reading frame.

 

Answer: C

Section: 17.1

Level: Medium

Blooms: Analysis

 

 

  1. Which one of the following statements is a feature of the wobble hypothesis?

 

  1. An amino acid-specific tRNA molecule can recognize only one codon.
  2. The wobble occurs only in the third base of the anticodon.
  3. When inosine (I) is the first nucleotide of an anticodon, at least three different codons for the same amino acid can be recognized.
  4. tRNA molecules can recognize codons that specify two different amino acids.

 

Answer: C

Section: 17.1

Level: Hard

Blooms: Knowledge

 

 

  1. Which one of the following base pairs is a wobble base pair?

 

  1. G-U
  2. G-C
  3. A-U
  4. A-T

 

Answer: A

Section: 17.1

Level: Medium

Blooms: Knowledge

 

 

  1. Which one of the following nucleotides does not form a wobble pair with inosine?

 

  1. C
  2. G
  3. U
  4. A

 

Answer: B

Section: 17.1

Level: Hard

Blooms: Knowledge

 

 

  1. The anticodon is found in which of the labeled regions of the tRNA shown here?

 

  1. A
  2. B
  3. C
  4. D

 

Answer: D

Section: 17.1

Level: Medium

Blooms: Knowledge

 

 

  1. tRNAs contain unusual nucleotides such as dihydrouridine, ribothymidine, inosine, and pseudouridine. What is the most likely explanation for how these unusual nucleotides become part of a tRNA?

 

  1. The unusual nucleotides were incorporated the RNA polymerase during transcription of the tRNA gene.
  2. The unusual nucleotides were inserted into the tRNA ribsosomes during translation.
  3. The unusual nucleotides are the products of enzymes that posttranscriptionally modify normal nucleotides.
  4. The unusual nucleotides are formed random mutation.

 

Answer: C

Section: 17.1

Level: Medium

Blooms: Evaluation

 

 

  1. The nucleotide positions of the codon and the anticodon are numbered 1, 2, and 3 in the 5′ to 3′ direction. What fundamental principle of nucleic acid interactions is manifest the observation that anticodon nucleotide 3 base pairs with codon nucleotide 1?

 

  1. Three hydrogen bonds are formed in G-C base pairs and two hydrogen bonds are formed in A-T base pairs.
  2. The base pairing of nucleic acids is antiparallel.
  3. Pyrimidines base pair with purines.
  4. Phosphodiester bonds are formed between a phosphate attached to the 5′ carbon and a hydroxyl group attached to the 3′ carbon in RNA.

 

Answer: B

Section: 17.1

Level: Medium

Blooms: Synthesis

 

 

  1. Table 17-1 lists the number of codons that encode for each amino acid. One of the four relationships proposed Francis Crick related to the wobble hypothesis is that when an amino acid is specified different codons, codons that differ in either of the first two bases require different tRNAs.  Which one of the following amino acids must have at least two different tRNAs?

 

 

  1. Arg
  2. Ala
  3. Ile
  4. Asn

 

Answer: A

Section: 17.1

Level: Medium

Blooms: Analysis

 

 

  1. Consider a mutation in which the codon CUU is changed to AUU. Which of the following statements is true with respect to this codon change?

 

  1. The mutation is a nonsense mutation.
  2. The mutation is a transition mutation.
  3. One hydrophobic amino acid is replaced with another hydrophobic amino acid.
  4. The mutation is suppressor mutation.

 

Answer: C

Section: 17.1

Level: Medium

Blooms: Knowledge

 

 

  1. Which one of the following statements about single-base substitutions is true?

 

  1. A base substitution in the third position of a codon always results in a missense mutation.
  2. A base substitution in the first position of a codon is most likely to result in a silent mutation.
  3. A transition mutation in the first position of a codon is most likely to result in a nonsense mutation.
  4. A transition mutation in the third position of a codon rarely results in an amino acid change.

 

Answer: D

Section: 17.2

Level: Medium

Blooms: Knowledge

 

 

  1. Because the genetic code is nonoverlapping, a missense mutation (from a single nucleotide change) results in the alteration of ______________­­, and the resulting protein has ______________.

 

  1. only one codon / at least three amino acid changes
  2. three codons / a single amino acid change
  3. only one codon / a single amino acid change
  4. three codons / three amino acid changes

 

Answer: C

Section: 17.2

Level: Medium

Blooms: Comprehension

 

 

  1. A nonsense mutation resulted in the RNA shown below. A tRNA anticodon sequence mutated from ______________ to CUA will result in translation to the peptide Met-Leu-Ala-Leu-Arg-Ser-Pro.

 

AUGCUUGCUUAGAGAAGUCCU

 

  1. AAC
  2. AAA
  3. ACC
  4. CAA

 

Answer: D

Section: 17.2

Level: Hard

Blooms: Synthesis

 

 

  1. The frameshift of an entire coding region of an mRNA is most likely to be caused a

 

  1. nonsense mutation.
  2. transition mutation.
  3. single nucleotide deletion.
  4. a double nucleotide mutation of an insertion and a deletion.

 

Answer: C

Section: 17.2

Level: Medium

Blooms: Comprehension

 

 

  1. Which one of the following experimental results provides evidence that the genetic code is read in triplets?

 

  1. When an insertion mutation and a deletion mutation are combined, the first mutation causes a frameshift but the second mutation restores the wild-type reading frame.
  2. The insertion of three consecutive nucleotides results in a relatively normal protein sequence.
  3. A single deletion mutation results in the inactivation of the gene, even when the mutation occurs in a region of the gene that can allow single nucleotide substitutions.
  4. When two insertion mutations occur, the first mutation causes a frameshift, but the second mutation cannot restore the wild-type reading frame.

 

Answer: B

Section: 17.2

Level: Medium

Blooms: Evaluation

 

 

  1. Acridine orange is a planar molecule that intercalates into DNA and can cause insertion or deletion (indel) mutations. Which of the following molecules is also planar and likely to cause insertion or deletion mutations?

 

 

 

 

  1. ethidium bromide
  2. lecithin
  3. methane
  4. capsaicin

 

Answer: A

Section: 17.2

Level: Medium

Blooms: Analysis

 

 

  1. Sydney Brenner and Francis Crick recombined the B genes from two mutant T4 phages containing insertion or deletion mutations and created a phage with a B gene containing two mutations instead of one. They repeated this experiment with many mutant T4 phage.  In some cases, the recombined gene restored normal function of the B gene (ability to infect multiple hosts).  Brenner and Crick interpreted this result as evidence that the reading frame in the recombined B gene, disrupted an insertion or deletion in one mutant B gene, was restored an insertion or deletion mutation in the other mutant B gene.  Below is a hypothetical wild-type gene sequence and four mutant gene sequences.  Which pair of mutant gene sequences, when recombined, would restore the reading frame of the wild type gene?  Of course, in between the mutations, the amino acids encoded the recombined gene will be different than the wild type.

 

Wild Type

CATCATCATCATCAT

 

Mutant I

CATACATCATCATCAT

 

Mutant II

CATTACATCATCAT

 

Mutant III

CATCATCATATCAT

 

Mutant IV

CATCATCATTCAT

 

  1. Mutant I and Mutant II
  2. Mutant II and Mutant IV
  3. Mutant III and Mutant IV
  4. Mutant I and Mutant III

 

Answer: D

Section: 17.2

Level: Hard

Blooms: Analysis

 

 

  1. Fragile X syndrome is clinically recognized intellectual disability, distinct facial features (e.g., enlarged face, large ears), repetitive movements (e.g., hand flapping), and anxiety. Humans with Fragile X syndrome have mutations in the FMR1 gene that encodes the fragile X mental retardation protein (FMRP), a protein essential for normal brain development.   The most common mutation is an increase in the number of CGG repeats in the gene.  The CGG sequence is repeated 10–40 times in normal genes, but is found increased to over 200 repeats in persons with Fragile X syndrome.   Huntington disease (loss of muscle coordination, cognitive decline) is caused mutations in the HTT gene, increasing the number of CAG repeats from 6–30 (normal) to over 36 CAG repeats.  These are two examples of dozens of human diseases that result from expansion of trinucleotide repeats.  In these trinucleotide repeat disorders, the affected protein is translated but because folding and quaternary/tertiary structure of the protein is altered due to the extra repeated amino acids, the protein does not function correctly.    Which of the following trinucleotides is the least likely to be involved in trinucleotide repeat disorders?

 

  1. ACG
  2. TAG
  3. GGG
  4. CTT

 

Answer: B

Section: 17.2

Level: Hard

Blooms: Synthesis

 

 

  1. After determining that the genetic code is read in triplet codons, the question arose as to whether the code was overlapping or nonoverlapping. If the code was overlapping, a change in one nucleotide could result in a change in how many amino acids?

 

  1. one
  2. two
  3. three
  4. five

 

Answer: C

Section: 17.2

Level: Easy

Blooms: Application

 

 

  1. The name of the enzyme used Nirenberg and Matthaei to synthesize RNA primers to direct in vitro protein synthesis using cell extracts is:

 

  1. polynucleotide phosphorylase.
  2. ribonucleotide synthetase.
  3. ribonucleotide reductase.
  4. deoxyribonuclease.

 

Answer: A

Section: 17.3

Level: Easy

Blooms: Knowledge

 

 

  1. Which one of the following statements about the use of synthetic polynucleotides in cracking the genetic code is not true?

 

  1. Poly(A) RNA directs the synthesis of only polylysine in vitro.
  2. Particular codons are generated in predictable ratios with random RNA polymers containing specific ratios of different nucleotides.
  3. Three different amino acids are incorporated into peptides when synthetic polymers of only one nucleotide are used to synthesize the RNA polymer.
  4. The codon table was completed using RNA polymers of defined sequences.

 

Answer: C

Section: 17.3

Level: Medium

Blooms: Application

 

 

  1. Which one of the following copolymeric peptides can be generated in vitro with the synthetic RNA polymer consisting of the repeating dinucleotide (AU)n?

 

  1. (Ile-Trp)n
  2. (Ile-Tyr)n
  3. (Leu-Asn)n
  4. (Tyr-Leu)n

 

Answer: B

Section 17.3

Level: Medium

Blooms: Analysis

 

 

  1. Which one of the following sets of homopolymeric peptides is generated in vitro with the synthetic RNA polymer consisting of the repeating trinucleotide (GUC)n?

 

 

  1. Poly(Val), Poly(Ala), and Poly(Leu)
  2. Poly(Ser), Poly(Gly), and Poly(Arg)
  3. Poly(Arg), Poly(Ser), and Poly(Val)
  4. Poly(Val), Poly(His), and Poly(Asn)

 

Answer: C

Section: 17.3

Level: Medium

Blooms: Analysis

 

 

  1. 14C-labeled lysine was added to an in vitro translation system consisting of purified components necessary for E. coli translation and the rest of the amino acids in unlabeled form. In one experiment, the in vitro translation was performed in the absence (-) of RNA template.  In a second reaction, in vitro translation was performed in the presence (+) of poly(U) RNA template.  The amount of radioactive polypeptide produced was measured as acid precipitable cpm.  Which of the results, A, B, C, or D, would be expected for these two experiments?

 

 

 

  1. A
  2. B
  3. C
  4. D

 

Answer: C

Section: 17.3

Level: Hard

Blooms: Evaluation

 

 

  1. The comet exploring Rosetta spacecraft, Philae, reports back the presence of single-celled organisms that resemble bacteria found on the comet C-G. A module from the spacecraft containing a sample of the organism is rocketed back to earth.  Amazingly, the comet organism can be grown in the lab.  It is determined that DNA and RNA and proteins are present in the comet organism, but that four of the nitrogenous bases are different from terrestrial nucleotides.  The comet organism’s nitrogenous bases are named A, B, C, and D.   Comet organism proteins were found to contain only the 20 amino acids regularly found as components of terrestrial proteins.  You are asked to decipher the genetic code of this comet organism.  You synthesize three polyribonucleotides consisting of various combinations of A, B, and C nitrogenous bases, and determine the amino acid sequence of any proteins synthesized during comet-organism cell-free in vitro translation.  The results are shown in the table below:

 

 

Polynucleotide sequence Amino acid sequence of polypeptide(s)
5′ BCBCBCBCBCBC….. 3′ …..GLY-ILE-GLY-ILE-GLY-ILE…..
5′ BBCBBCBBCBBC….. 3 ‘ …..GLY-GLY-GLY-GLY-GLY…..
…..ASN- ASN- ASN- ASN- ASN…..
…..TYR-TYR-TYR-TYR-TYR…..
5′ ABBCABBCABBCABBC….. 3′ …..LYS-THR-VAL-TYR-LYS-THR-VAL-TYR…..

 

If the genetic code of the comet organism is a triplet, nonoverlapping code with no commas, what is the codon for asparagine?

 

  1. BBC
  2. BCB
  3. CBB
  4. BBB

 

Answer: C

Section: 17.3

Level: Hard

Blooms: Evaluation

 

 

  1. You synthesize polyribonucleotides using a molar ratio of 3 Uracil : 1 Guanine. The resulting polyribonucleotide sequences are random but each polyribonucleotide follows the 3:1 ratio.  When this mixture of polyribonucleotides is used as template for translation, proteins with different amino acid sequences are obtained.  When you determine the amino acids present in the proteins, you obtain the frequencies for each amino reported in the table below.  The frequency of phenylalanine was normalized to 1 and all other amino acids are reported as a frequency of occurrence compared to phenylalanine.  As an example of understanding the data, the amino acid glycine frequency is 0.12, meaning that glycine was present in the mixture of polypeptides at a ratio of 12 glycine residues (amino acids) for every 100 phenylalanine residues (amino acids).

 

Amino acid Frequency
Phenylalanine 1.00
Leucine 0.37
Valine 0.36
Cysteine 0.35
Tryptophan 0.14
Glycine 0.12

 

Which one of the following statements about this experiment is true?

 

  1. The most likely codon present in the polyribonucleotides synthesized under these conditions is GGG.
  2. Codons consisting of one guanine and two uracils, in any order, are likely to encode for either valine, leucine, or cysteine.
  3. A codon for tryptophan is as likely to be present as is the codon for phenylalanine.
  4. Since only poly(G) and poly(U) RNA are present, the presence of valine shows ribosome slippage during translation.

 

Answer: B

Section: 17.3

Level: Hard

Blooms: Evaluation

 

 

  1. When cysteine-tRNAcys is treated with nickel hydride, alanine-tRNAcys is the product. Alanine-tRNAcys will base pair with which codon?

 

  1. UGC
  2. GCU
  3. AUG
  4. AGU

 

Answer: A

Section: 17.3

Level: Medium

Blooms: Analysis

 

 

  1. Sidney Brenner found bacteriophage T4 point mutants in which a protein was prematurely terminated. The premature termination point of the protein was different in different mutants.  When he determined where the protein synthesis terminated for each mutant, in every case the next amino acid of the protein would have been a glutamine, lysine, glutamic acid, tyrosine, or serine.  What is the unique similarity of these amino acids or their codons that would play a role in the premature termination of translation in the mutant protein gene?

 

  1. Each of the amino acids has an R-group containing an amine, hydroxyl, or carboxyl group.
  2. Each of the codons for these amino acids contains either U or G.
  3. Each of the codons for these amino acids could be changed to UAG with a single nucleotide mutation.
  4. Each of the amino acids is polar and charged.

 

Answer: D

Section: 17.3

Level: Hard

Blooms: Evaluation

 

 

  1. Which one of the following is an exception to the rules of the genetic code?

 

  1. Specific codons specify the same amino acids in Escherichia coli cells as in human cells.
  2. The codon UGA is a stop codon in the mitochondria of higher plants.
  3. A selenocysteine amino acid is incorporated into proteins in response to a UAG codon.
  4. The cell only requires 32 different tRNAs to recognize 61 different codons.

 

Answer: C

Section: 17.4

Level: Medium

Blooms Analysis

 

 

  1. Which one of the following statements about the incorporation of selenocysteine into proteins is true?

 

  1. Selenocysteine is an example of a posttranslational modification.
  2. The tRNA used to translate selenocysteine at a stop codon is first charged with serine.
  3. The tRNA used to translate selenocysteine at a stop codon has an anticodon sequence of UGA.
  4. The serine bound to the tRNA used to translate selenocysteine at a stop codon is converted to selenocysteine the enzyme SelB.

 

Answer: B

Section: 17.4

Level: Medium

Blooms: Analysis

 

 

  1. Exceptions to the genetic code have been identified. Which one of the following is a known exception?

 

  1. A codon might not always encode the same amino acid.
  2. A single stop codon, UGG, may be the only stop codon recognized.
  3. Alanine codons instead of methionine codons may be used for the initiation of translation.
  4. The codons in mitochondria are reversed (e.g., instead of AUG, the methionine codon in mitochondria is GUA).

 

Answer: A

Section: 17.4

Level: Easy

Blooms: Knowledge

 

 

  1. Which of the following is incorrect with respect to translation and the genetic code?

 

  1. In bacteria, there is a direct correlation between the order of amino acids and the order of nucleotides in the gene encoding for a protein.
  2. The insertion of one or two nucleotides into the coding sequence will cause a shift in the reading frame.
  3. A codon is three nucleotides in length.
  4. AUG is the start codon and encodes for a methionine (or derivative of methionine) at the carboxyl end of the protein.

 

Answer: D

Section: 17.4

Level: Easy

Blooms:  Comprehension

 

 

  1. In 1979, a group at Cambridge discovered that in human mitochondria, UGA is not a stop codon but instead during translation results in the delivery of the amino acid tryptophan. It was extremely unexpected to discover that one organism could have two different genetic codes, and that the genetic code was not universal—it is mostly or nearly universal.  The evolutionary history of the genetic code is an area of robust debate.  Which of the following statements about the evolution of the genetic code is most likely true?

 

  1. There is no chemical correspondence between codons and amino acids—the code is arbitrary in its origin.
  2. The presence of genetic code alternatives directly challenges the concept of a common ancestor for humans and E.coli.
  3. Life arose twice as independent events.
  4. The genetic code has a small number of alternative states but these differences cannot be used like nucleotide differences in the genome to infer phylogenies (relationships).

 

Answer: A

Section: 17.4

Level: Easy

Blooms: Evaluation

 

 

  1. The codons UCU, UCC, UCA, and UCG all code for the same amino acid, serine. In which position of the codon are mutations most likely to be found when comparing the same gene of two closely related species?

 

  1. position 1
  2. position 2
  3. position 3
  4. none of the positions; any change will be lethal.

 

Answer: C

Section: 17.4

Level: Easy

Blooms: Synthesis

 

 

  1. Which of the following statements is consistent with the observation that the genetic code is nearly universal for all currently known life?

 

  1. All organisms can reproduce with any other organism.
  2. All organisms have a common ancestor.
  3. All organisms have the same evolutionary genes.
  4. All organisms arose at the same time in the history of the earth.

 

Answer: B

Section: 17.4

Level: Easy

Blooms: Evaluation

 

 

Related products